1
newbie hereview story

http://forums.androidcentral.com – What's going, all? I'm new to android and want to learn and maybe get some advice on some devices. I'm here in hell's waiting room, Texas. ... (HowTos)

1
Getting matched fasta fileview story

http://unix.stackexchange.com – list.txt 58759__len__2903 58759__len__2903 673957__len__1655 673957__len__1655 3566454__len__1744 seq.fasta >58759__len__2903 TTTTCCGTAGAGGAGATCCCTATTTTTAGGTTTGTAAGAGATCATTTT >67777__len__2978 TTTTTAGGTTTGTAAGACCGTAGAG >673957__len__1655 CCCTATTTTTAGGTTTGTAAGGTTTGTAAGACCGTAGAG >3566454__len__1744 GGTTTGTAAGACCGTAGAGGGTTTGTAAGACCGTAGAG output.fasta >58759__len__2903 TTTTCCGTAG (HowTos)

1
Need Immediate Help for Kubuntu installationview story

https://www.kubuntuforums.net – I am very new for Kubuntu and other Linux OS. (HowTos)

1
Controlling cellular data use by app ala iOSview story

http://androidforums.com – In the stock android main settings you can manually restrict background data for individual apps (though the settings menu prompts you that it is usually better to find the option for this within the app itself which clearly seems to be the android paradigm). I don't see anyway though, to centrally control foreground data for individual apps. I.e. (General)

1
unhelpful Windows error.view story

http://www.overclock.net –  "I was trying to run Solitaire in Windows 8.1 when it gave me an error message "this app..." (Hardware)

1
Scare Cam Prank - Customizable Camera Prank App to scare your friend.view story

http://androidforums.com – https://play.google.com/store/apps/details?id=com.raj.scarecamprank Description: Customizable Camera Prank App to scare your friend. Open the app give your phone to take a pic. (General)

1
Arch, Ubuntu: So what's the deal with libudev.so.0?view story

http://unix.stackexchange.com – I'm interested in building Linux desktop apps with Web front-end technologies. (HowTos)

1
Resources for learning Linuxview story

http://unix.stackexchange.com – I'm new to linux. (HowTos)

1
about backupview story

http://forums.androidcentral.com – some days ago I have lost my all characters from my game Injustice GAU. I remember, I have been clicked on google sign in for "dont show me again",... (HowTos)

1
Frame rate limiting not working in BF4view story

http://www.overclock.net –  "Hey all, I'm trying to test out some frame rate limiting options (besides in game..." (Hardware)

1
Hey allview story

http://forums.androidcentral.com – Hey all, Just joined. (HowTos)

1
How can I remove menues from Adobe Reader?view story

http://superuser.com – In Adobe Reader 11.0.09 there are some pesky menue items (marked in red in the screen shot below) which block my menue items (marked in green) from being displayed on the menue bar. How do I get rid of those "red" items, please? Screen shot (HowTos)