3

split file by delimiter with csplit

view full story
linux-howto

http://www.unix.com – Hello, I want to split a big file into smaller ones with certain "counts". I am aware this type of job has been asked quite often, but I posted again when I came to csplit, which may be simpler to solve the problem. Input file (fasta format): Code: >seq1 agtcagtc agtcagtc ag >seq2 agtcagtcagtc agtcagtcagtc agtcagtc >seq3 agtcagtcagtcagtc agtcagtcagtcagtc agtcagtcagtcagtc >seq4 agtcagtcagtcagtcagtcagtc >seq5 agtcagtc >seq6 agtcagtcagtcagtcagtcagtcagtcagtcagtc agtcagtcagtcagtcagtcagtcagtcagtcagtc agtcagtcagtcagtcagtcagtc I want output file by sequence counts (sa (HowTos)